 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yfmIJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yfmI | - | 819311..820531 | ||||
| yfmJ | - | 817810..818829 | COG2130R |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | The Northern blotting results in BSORF suggest the existence of an internal promoter in front of yfmJ. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Spo0A | Positive | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAACGGGAGGGCTTTTTGCCCTCCTTTTGTGTTTCGATG >>>>>>> <<<<<<< |
yfmJ |
|