 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yhjCB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yhjC | - | 1120628..1120828 | ||||
| yhjB | - | 1119162..1120631 | COG0591ER |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Genbank Y14081 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | ND | 1120937..1120958 | AAAATAAATTTATTTATAATTC |
Ogura M, et al. (2002): AR RG HM DB |
| ComK | Positive | ND | 1120902..1120922 | CACTCCAAAAAATGACATGTG |
Ogura M, et al. (2002): AR RG HM DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCAATCTGGACACCAGATTGCTTTTTCTTATTTACC >>>>>>>>> <<<<<<<<< |
yhjB |
|