 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ykvR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ykvR | + | 1447251..1447541 |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Au N, et al. (2005) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 1447123..1447145 | TTAACGAACGTATGTTTGTAAAG |
Au N, et al. (2005): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AATAGACAAAAACGCCGATTCATGATCGGTGTTTTTTATGTAAAAA >>>>>>>> <<<<<<<< |
ykvR |
|