 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yozM |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yozM | + | 2065042..2065377 |
| Operon evidence: | Upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Au N, et al. (2005) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| LexA | Negative | ND | 2064897..2064920 | TCAACAGAACAAACGTTCCTTATT |
Au N, et al. (2005): GS |
| LexA | Negative | ND | 2064927..2064950 | AGATCAGAACAAAAGTTCGATGTA |
Au N, et al. (2005): GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAGCAATTAAAACTGGACGTTAAAAAACATTAGTTATTCTTTATTTTTTTT >>>>>>>>>>> <<<<<<<<<< |
yozM |
|