| Regulated Operon: | yppF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yppF | + | 2338582..2338770 |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strands |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Spo0A | Positive | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GCCCCCTATAAAAACGAAAAGAAGACAGCCTTTTACCGGCTGTCTTCTCTTGCAATTTC >>>>>>> <<<<<<< |
yppF |


|