 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ywdIJK |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ywdI | ipa-59d | - | 3895805..3896161 | |||
| ywdJ | ipa-60d | - | 3894463..3895785 | COG2233F | ||
| ywdK | ipa-61d | - | 3894030..3894401 | COG2363S | x0444-BAC |
| Operon evidence: | Northern blotting (2.2 kb transcript); downstream gene is on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2003), Presecan E, et al. (1997) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TnrA | Negative | ND | 3896198..3896214 | TGTCAGAAAAAATAACA |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCCAATCCTCATCATATGAGTGATTGGCTTTTTTCTTATCTTG >>>>>>>>>>>> <<<<<<<<<<<<< |
ywdK |
|