 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxbBA-yxnB-asnH-yxaM |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxbB | yxaP | + | 4097416..4098150 | COG2226H | ||
| yxbA | yxaO, yxaO | + | 4097170..4097439 | |||
| yxnB | + | 4098423..4098905 | ||||
| asnH | yxaN | + | 4098926..4101169 | COG0367E | ||
| yxaM | + | 4101166..4102365 | COG2814G |
| Operon evidence: | Northern blotting (5.5 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (1999), Yoshida K, et al. (2000) |
| Comments: | Yoshida et al. (2000) found several shorter transcripts, starting at the promoter in front of yxbB. These transcripts are not mentioned in Yoshida's 1999 paper. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AbrB | Negative | ND | ND | ND |
Hamon MA, et al. (2004): AR RT-PCR |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATCACAGTAAGAAGACCTTCTTATTAAAAGAAGGTCTTCTGCTATTCTATTCAGTTATT >>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<< |
yxaM |
|