Transcription factor: LevR

Factor type NifA/NtrC
SWISS-PROT ND
SubtiList ND
Consensus seq. ND
Comment Activator which regulates the neighboring operon. Note that -144:-130 and -108:-120 makes a palindromic structure
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
levDEFG-sacC levD SigL Positive 2762968..2763010 -148:-106 TATGAACCTGTATTAAATGGAACACCATTTTAATACAGGTTTA Debarbouille M, et al. (1991): DB RG
Martin-Verstraete I, et al. (1994): DP DB GS FT
levDEFG-sacC levD SigL Positive 2762931..2762954 -92:-69 AAGTGTTTCAACAACAAATTGCTA Debarbouille M, et al. (1991): DB RG
Martin-Verstraete I, et al. (1994): DP SDM GS FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai