Transcription factor: SigL

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TGGCACN(5)TTGCA
Comment RNA polymerase Sigma-54 factor (Sigma L)
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
acoABCL acoA 878940..878979 -34:+6 AAAAGACTGGCACACTTCTTGCATTTATAATGGTGAACCC Ali NO, et al. (2001): PE HM
levDEFG-sacC levD 2762858..2762897 -35:+5 ACTGTGTTGGCACGATCCTTGCATTATATATGGATGTACA Martin I, et al. (1989): PE
Debarbouille M, et al. (1991): DB RG
ptb-bcd-buk-lpdV-bkdAABB ptb 2504685..2504726 -34:+8 TAAGAGCTGGCATGGAACTTGCATAATAAAAGGCGGAGTCGA Debarbouille M, et al. (1999): PE
rocABC rocA 3880546..3880585 -35:+5 AAGAAAATGGCATGATTCTTGCATTTTTATTCATATGCGA Calogero S, et al. (1994): PE
rocDEF rocD 4145549..4145588 -35:+5 CTTGATTTGGCACAGAACTTGCATTTATATAAAGGGAAAG Gardan R, et al. (1995): PE
rocG rocG 3882094..3882135 -34:+8 CAAAAGCTGGTACGGATCTTGCATGATGATAAGGGTGAATCC Belitsky BR & Sonenshein AL (1999): PE




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai