 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | acoABCL |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| acoA | yfjK | + | 879002..880003 | COG1071C | acoA-BAC acoA-STR | |
| acoB | yfjJ | + | 880007..881035 | COG0022C | acoB-BAC | |
| acoC | yfjI | + | 881049..882245 | COG0508C | acoC-BAC acoC-STR | |
| acoL | yfjH | + | 882266..883642 | COG1249C | acoL-BAC |
| Operon evidence: | Northern blotting (4637 bp transcript); transcriptional fusions |
|---|---|
| Reference: | Ali NO, et al. (2001), Reents H, et al. (2006), BSORF |
| Comments: | Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| AcoR | Positive | -123:-60 | 878851..878914 | CGAGACAAATGAATCAGTTTGAGACAAAACGAGACACACGTCTCAAACTGTCTCCAAAGTGAAG |
Ali NO, et al. (2001): RG |
| CcpA | Negative | +459:+481 | 879432..879454 | AAAATGTAAGCGTTTGCTTTTTC |
Miwa Y, et al. (2000): RG |
| SigL | Promoter | -34:+6 | 878940..878979 | AAAAGACTGGCACACTTCTTGCATTTATAATGGTGAACCC |
Ali NO, et al. (2001): PE HM |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCAGGCGCATGGATATAAGGCGCCTGCTTTTTTATTGTTGAA >>>>>>>> <<<<<<<< |
acoL |
|