| Regulated Operon: | acoR-sspH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| acoR | yzcB | + | 883758..885575 | COG3284QK | x0536-BAC | |
| sspH | yfjU | + | 885629..885808 |
| Operon evidence: | Northern blotting; downstream gene is transcribed in the opposite direction |
|---|---|
| Reference: | Cabrera-Hernandez A, et al. (1999), Ali NO, et al. (2001), BSORF |
| Comments: | Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH trancript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| CcpA | Negative | ND | 883687..883712 | ATTGTTGAAAGCGCTTTATTTTTCCC |
Ali NO, et al. (2001): FT |
| SigG | Promoter | -40:+2 | 885573..885614 | TAAAGCATACTTCCTTCAGGAAATGGAAACGTTATGTATTGA |
Cabrera-Hernandez A, et al. (1999): PE RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATGGCCCGCTTCATAAGCAGGCCATTTTGTTATCCGCGC >>>>>>>>>> <<<<<<<<<< |
sspH |


|