 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | comFABC-yvyF-flgM-yvyG-flgKL |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| comFA | - | 3642167..3643558 | COG4098L | |||
| comFB | - | 3641811..3642107 | ||||
| comFC | - | 3641125..3641814 | COG1040R | |||
| yvyF | yviB | - | 3640632..3641051 | |||
| flgM | - | 3640285..3640551 | COG2747KNU | |||
| yvyG | yviC | - | 3639787..3640269 | |||
| flgK | - | 3638245..3639768 | COG1256N | x1601-BAC | ||
| flgL | yviD | - | 3637338..3638234 | COG1344N |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Londono-Vallejo JA & Dubnau D (1993), Soldo B, et al. (1996), Mirel DB, et al. (1994), Liu J & Zuber P (1998), Serizawa M, et al. (2004) |
| Comments: | Insertion mutations and RT-PCR by Liu & Zuber showed the presence of a comF-flgM transcript, suggesting that the stem-loop downstream of comFC functions as a readthrough terminator. Soldo et al. suggest that the stem-loop structure downstream of flgL may be an mRNA stabilizer rather than a terminator. In that case, the operon would also contain the genes yviE, yviF, and csrA. Serizawa et al. show that yviE-yviF, like the operon containing yvyF, are SigD-dependent. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Positive | -92:-63 | 3643638..3643667 | ATAAGGCCAAATCTCCGTTTTTAGAGCGGA |
Londono-Vallejo JA, et al. (1993): DB RG Van Sinderen D, et al. (1995): GS RG OV Hamoen LW, et al. (1998): FT Liu J & Zuber P (1998): DB Ogura M, et al. (2002): AR RG DB |
| ComK | Positive | -63:-33 | 3643608..3643638 | AGATTTTTTTATATTCTTATTTTAATAGTTG |
Londono-Vallejo JA, et al. (1993): DB RG Van Sinderen D, et al. (1995): GS RG OV Hamoen LW, et al. (1998): FT Liu J & Zuber P (1998): DB Ogura M, et al. (2002): AR RG DB |
| SigA | Promoter | -46:+19 | 3643557..3643621 | TATTTTAATAGTTGGACAGAAAATATTCATTCAGGCATACTGTTTCGAAAGGAGGCGTGCTATGT |
Londono-Vallejo JA, et al. (1993): PE S1 |
| SigD | Promoter | -40:+5 | 3641089..3641133 | AGAAGCTAAATGATTCTGTTTTTATGCCGATATAATCACTAGAAA |
Gilman MZ, et al. (1981): S1 RO, in-vitro transcription Gilman MZ & Chamberlin ML (1982): S1 Mirel DB, et al. (1994): RO |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTGATCAGAAGCTAAATGATTCTGTTTTTATGCCGATAT >>>>> <<<<< |
comFC | |||
| AGTAAGCGGCTCTTAGGAGTTCGCTTTTTTTATAGTTCA >>>>>>> <<<<<<<< |
flgL |
|