 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | degR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| degR | prtR | - | 2308157..2308339 |
| Operon evidence: | upstream and downstream genes are in the opposite direction |
|---|---|
| Reference: | Nagami Y & Tanaka T (1986) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComK | Negative | ND | ND | ND |
Ogura M & Tanaka T (1996): DB RG Ogura M, et al. (1997): DB DP |
| SigD | Promoter | -41:+8 | 2308396..2308444 | CAAAATAGAAAAGAAAATAAAAATAAGCCGATATAACTATTGAACCAGA |
Helmann JD, et al. (1988): Genetics and Biotechnology of Bacilli, Vol. 2, pp. 189-193: in-vitro transcription Ogura M, et al. (1996): RG DB PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAAATAGGAGAGGCGAATGCCTCTCCTCTATTTGTCATCTCATCA >>>>>>>>> <<<<<<<<< |
degR |
|