| Regulated Operon: | glcU-gdh |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| glcU | ycxE | + | 444461..445324 | COG4975G | x0378-BAC | |
| gdh | + | 445344..446129 | COG1028IQR | gdH-BAC gdH-BAC |
| Operon evidence: | 5' primer extension analysis of gdh; genes downstream of gdh are on the opposite strand; Northern blotting (1.6 kb transcript) |
|---|---|
| Reference: | Rather PN & Moran CP Jr (1988), Lampel KA, et al. (1986), Nakatani Y, et al. (1989), BSORF, Uratani B, Lampel KA, Lipsky RH, Freese E: Molecular Biology of Microbial Differentiation, edited by J.A. Hoch & P. Setlow, American Society for Microbiology, pp. 71-76 (1985) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigG | Promoter | -40:+7 | 444390..444436 | TTCCGGCGAATAATCACAACAATTCCAGCCAAAATAACAGCAAATAC |
Rather PN & Moran CP Jr (1988): PE, promoter mutation |
| SpoVT | Negative | ND | ND | ND |
Bagyan I, et al. (1996): DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGACCCAGACATGACATCTGGATCGCTTTCTTTATTAGGCA >>>>>>>>>> <<<<<<<<<< |
gdh |


|