Regulated Operon: | glyQS |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
glyQ | yqfJ | - | 2607762..2608649 | COG0752J | glyQ-BAC glyQ-LAB glyQ-STR | |
glyS | yqfK | - | 2605730..2607769 | COG0751J | x0027-CLO |
Operon evidence: | Genome analysis |
---|---|
Reference: | |
Comments: | Transcriptional readthrough occurs at the stem-loop upstream of glyQ if uncharged glycine tRNA binds to the T-box motif in the nascent mRNA transcript. The tRNA anticodon binds to the GGC codon in the sequence AAAGGCAUU in the glyQ leader mRNA. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
TrnB-Gly1 | Positive | ND | 2608746..2608771 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
TrnD-Gly | Positive | ND | 2608746..2608771 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
TrnI-Gly | Positive | ND | 2608746..2608771 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
TrnJ-Gly | Positive | ND | 2608746..2608771 | GCAACTAGGGTGGAACCGCGGGAGAA |
Grundy FJ, et al. (2002): RO RG SDM Yousef MR, et al. (2005): Size-exclusion filtration |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CGCGGGAGAACTCTCGTCCCTATGTTTGCGGCTGGCAAGCATAGAGACGGGAGTTTTTTGGTTGCTGC >>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<< |
glyQ |
|