 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | hxlAB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| hxlA | yckG | - | 375166..375798 | COG0269G | ||
| hxlB | yckF | - | 374603..375160 | COG0794M |
| Operon evidence: | Northern blotting (1.3 kb transcript found with hxlB probe; 1.5 kb transcript found with hxlA probe; 1.2 kb transcript from Nguhen TT, et al. (2009))) |
|---|---|
| Reference: | Nguyen TT, et al. (2009), Yasueda H, et al. (1999), Hanlon DW, et al. (1994), BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| HxlR | Positive | ND | 1891808..1891840 | CACCTATTAGTTTGTTGTTTAAACAAACTAACT |
Yasueda H, et al. (1999): NMR, GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CACAACCGGCCTGAAGATCAGGCCGGTTTTATTTTTTCTAA >>>>>>>>> <<<<<<<<< |
hxlB |
|