 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | ND |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | ND |
| Comment | positive regulator of hxlAB expression |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| hxlAB | hxlA | None | Positive | 1891808..1891840 | None | CACCTATTAGTTTGTTGTTTAAACAAACTAACT |
Yasueda H, et al. (1999): NMR, GS |
|