| Regulated Operon: | mcpC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| mcpC | prg71 | + | 1463628..1465595 | COG0840NT | x0816-BAC |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Muller J, et al. (1997) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigD | Promoter | -43:+9 | 1463571..1463622 | TTTGATTATTCATTTTTCAAACGAAAGGGCCGATATAGAAATTAGGAGGGGA |
Muller J, et al. (1997): PE DB RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTACATCCCCAAACATCATTTGTTTTGGGGATTTTTTATTTTATAA >>>>>>>>>> <<<<<<<<<<< |
mcpC |


|