Regulated Operon: | mmsA-iolBCDEF-idh-iolHI-fbaB |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
mmsA | yxdA | - | 4082920..4084383 | COG1012C | x1017-BAC | |
iolB | yxdB | - | 4082030..4082845 | COG3718G | ||
iolC | yxdC | - | 4081029..4082006 | COG0524G | iolC-BAC-1 iolC-BAC-2 | |
iolD | yxdD | - | 4079083..4080996 | COG3962E | ||
iolE | yxdE | - | 4078173..4079066 | COG1082G | iolE-BAC | |
iolF | yxdF | - | 4076842..4078158 | COG2814G | ||
idh | iolG, iol, iol | - | 4074801..4075835 | myo-inositol 2-dehydrogenase | idh-BAC idh-BAC | |
iolH | yxdG | - | 4074896..4075765 | COG1082G | ||
iolI | yxdH | - | 4073974..4074810 | COG1082G | ||
fbaB | iolJ, yxdI, yxdI | - | 4072097..4072969 | fructose-1,6-bisphosphate aldolase | fbaA-BAC |
Operon evidence: | S1 nuclease mapping of the 3' end; Northern blotting (11.5 kb transcript) |
---|---|
Reference: | Yoshida K, et al. (1994), Yoshida KI, et al. (1997), Yoshida K, et al. (2000) |
Comments: | The proposed terminator agrees well with the experimentally determined termination site in the TTTTTTT stretch. |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
CcpA | Negative | +83:+110 | 4084465..4084492 | TTTTTGAAAGCGTTTAATTCTTGGCTTG |
Miwa Y, et al. (2000): DP SDM |
IolR | Negative | -107:-45 | 4084619..4084681 | CCTTCTCTTACTTCTCTTACTTGATTAAAAGATTAATATAATAAAAATAATGAAAAAATGTAG |
Yoshida KI, et al. (1997): DB DP HB |
IolR | Negative | -5:+17 | 4084558..4084579 | TAACCAAGAAATGACCAAAAAG |
Yoshida KI, et al. (1999): GS FT |
SigA | Promoter | -39:+8 | 4084567..4084613 | ATGATTGACTTATGGGTATTATGCGATTAGAATATAACCAAGAAATG |
Yoshida KI, et al. (1997): PE |
CcpA | Negative | ND | 4082159..4082181 | GAAATGAAAACGTTGTCATCGTT |
Miwa Y, et al. (2000): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
GAAACCGCCGAGATGGCGGTTTTTTTGTGCGGTG >>>> <<<< |
iolI |
|