 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | rapD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| rapD | ywpA | + | 3744349..3745413 |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Huang X & Helmann JD (1998) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| YvaN | Negative | ND | ND | ND |
Ogura M & Fujita Y (2007): AR DB RG GS |
| SigA | Promoter | -41:+6 | 3744278..3744324 | CTGTCAATGAGAGCCGTCAAAAGTTATGATATGATAATTATAGATTT |
Huang X & Helmann JD (1998): PE RO RG Jarmer H, et al. (2001): HM |
| SigX | Promoter | -37:+5 | 3744267..3744308 | AATGTAACCAACTGTCAATGAGAGCCGTCAAAAGTTATGATA |
Huang X & Helmann JD (1998): RG DB PE RO |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAGCCGCTTTTTTTATCATGCGCGGCTGATTGAAAAACGCCCATTTTCTTATTATCTG >>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<< |
rapD |
|