| Regulated Operon: | rapF-phrF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| rapF | ywhJ | + | 3846001..3847146 | |||
| phrF | ywhI | + | 3847130..3847249 |
| Operon evidence: | Primer extension of phrF; genome analysis |
|---|---|
| Reference: | McQuade RS, et al. (2001), Genbank Z80360 |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| ComA | Positive | ND | ND | ND |
Bongiorni C, et al. (2005): RG DB |
| SigH | Promoter | -36:+5 | 3847007..3847047 | TTGAAGATTTCGCTATTGATGTGGCAAAATATTATCATGAA |
McQuade RS, et al. (2001): PE RG DB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TTTAACCGCCGTCCATCGGCGGTTTTTTCGTCCCCTC >>>>>> <<<<<< |
phrF |


|