Regulated Operon: | rapF-phrF |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
rapF | ywhJ | + | 3846001..3847146 | |||
phrF | ywhI | + | 3847130..3847249 |
Operon evidence: | Primer extension of phrF; genome analysis |
---|---|
Reference: | McQuade RS, et al. (2001), Genbank Z80360 |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
ComA | Positive | ND | ND | ND |
Bongiorni C, et al. (2005): RG DB |
SigH | Promoter | -36:+5 | 3847007..3847047 | TTGAAGATTTCGCTATTGATGTGGCAAAATATTATCATGAA |
McQuade RS, et al. (2001): PE RG DB |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
TTTAACCGCCGTCCATCGGCGGTTTTTTCGTCCCCTC >>>>>> <<<<<< |
phrF |
|