Regulated Operon: | rsfA |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
rsfA | ipa-92r | + | 3861437..3862213 | COG1792M |
Operon evidence: | upstream and downsteam genes are in the opposite direction |
---|---|
Reference: | Glaser P, et al. (1993) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
RsfA | Negative | ND | ND | ND |
Juan Wu L, et al. (2000): RG DB |
SigF | Promoter | ND | ND | ND |
Juan Wu L, et al. (2000): RG DB OV |
SigG | Promoter | ND | ND | ND |
Juan Wu L, et al. (2000): RG DB OV |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAATCCCAAAACGGGCAGCTGTTTTGGGATTTTCGCCATGTGCA >>>>>>>>>>> <<<<<<<<<<< |
rsfA |
|