| Regulated Operon: | sspOP | 
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups | 
|---|---|---|---|---|---|---|
| sspO | cotK | - | 1926306..1926452 | sspO-BAC sspO-BAC | ||
| sspP | cotL | - | 1926128..1926274 | 
| Operon evidence: | lacZ-sspP transcriptional fusion | 
|---|---|
| Reference: | Cabrera-Hernandez & Setlow P (2000) | 
| Comments: | no transcriptional fusion experiment was performed for the downstream cotM gene | 
| Binding factor | Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence | 
|---|---|---|---|---|---|
| SigG | Promoter | -41:+8 | 1926457..1926505 | GCTCTCTCATATAACACAATAAAAGAAGCCATATTATGATTGAGGTGAT | Cabrera-Hernandez A & Setlow P (2000): PE | 
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] | Downstream of | 
|---|---|---|---|---|
| AAAAGCAGACCTTAGTGTCTGTTTTTTTATGCGTTC >>>>> <<<<< | sspP | 


| 
 |