Regulated Operon: | tnrA |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
tnrA | scgR | - | 1397411..1397743 | COG0789K | tnrA-BAC |
Operon evidence: | upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Genbank U55004 |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
TnrA | Positive | ND | 1397808..1397824 | TGTTAGAAAATATGACA |
Robichon D, et al. (2000): DE DP |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
TAAAAGTCCGGCTCGCAGTTGAGACGGACTTTTTACGTTTATAA >>>>>>>>> <<<<<<<<< |
tnrA |
|