Regulated operon: trpEDCFBA-hisC-tyrA-aroE

Regulated Operon:

trpEDCFBA-hisC-tyrA-aroE

Genes

Genes	Synonyms	Direction	Genome position	Function	COG ID	Conserved groups
trpE		-	2375869..2377416		COG0147EH	x1522-STA
trpD		-	2374881..2375897		COG0547E
trpC		-	2374139..2374888		COG0134E
trpF		-	2373487..2374134		COG0135E
trpB		-	2372304..2373506		COG0133E
trpA		-	2371508..2372311		COG0159E
hisC	aroJ	-	2370415..2371497		COG0079E	x1197-BAC x1361-STA x1594-BAC
tyrA		-	2369251..2370366		COG0287E	tyrA-STA
aroE		-	2367954..2369240		COG0128E	aroE-BAC aroE-STA

Operon evidence:	integrative plasmids to interrupt transcription
Reference:	Shimotsu H & Henner DJ (1984), Henner DJ, et al. (1985), Henner DJ, et al. (1986), Shimotsu H, et al. (1986), Babitzke P & Gollnick P (2001)
Comments:	Transcription starting from the promoter in front of aroF leads to an aroFBH-trpEDCFVA-hisC-tyrA-aroE transcript and an aroFBH transcript, terminating at the terminator/antiterminator structure in front of trpE, as shown by Northern blotting, 3' S1 nuclease mapping, promoter deletions, site-directed mutagenesis, and reporter gene fusions. Readthrough transcription takes place under tryptophan limitation. The MtrB product (TRAP) causes both transcriptional and translational attenuation. In case of transcriptional attenuation, termination occurs at the GT in the T-stretch TTTATTTGT. NusA stimulates transcriptional pausing and termination. Translational attenuation may be followed by transcriptional attenuation further downstream: The absence of the ribosome allows access of the Rho protein to the nascent mRNA transcript, resulting in Rho-dependent transcriptional termination. An internal promoter may exist upstream of hisC.

Promoters

Binding factor	Regulation	Location	Absolute position	Binding seq.(cis-element)	Experimental evidence
Rho	Negative	ND	ND	ND	Yakhnin H, et al. (2001): DB RG HB
SigA	Promoter	`-47:+8`	2377612..2377666	`CCGATTTATCATTGACAAAAAATACTGAATTGTAATACGATAAGAACAGCTTAGA`	Shimotsu H & Henner DJ (1984): S1 DP RG Shimotsu H, et al. (1986): S1
MtrB	Negative	ND	2377529..2377584	`TAGAATGAGTTGAGTTAGAGAATAGGGTAGCAGAGAATGAGTTTAGTTGAGCTGAG`	Steinberg W (1974): anthranilate and tryptophan synthase measurement Kane JF (1977): DB, tryptophan excretion measurement Shimotsu H & Henner DJ (1984): DP Shimotsu H, et al. (1986): NB DP SDM RG Kuroda MI, et al. (1988): DP RG Gollnick P, et al. (1990): DB RG OV Babitzke P, et al. (1992): RG OV Otridge J & Gollnick P (1993): RO NB GS Babitzke P & Yanofsky C (1993): RO NB OV GS DP Babitzke P, et al. (1994): filter binding assay, FT Antson AA, et al. (1995): DP RG SDM Merino E, et al. (1995): RG SDM DP Lee AI, et al. (1996): DB RG DP Yang M, et al. (1997): RG GS DB Du H & Babitzke P (1998): RG DB, in-vitro translation, ribosome toeprint, RNA structure mapping Sudershana S, et al. (1999): DP RG SDM DB GS OV NB, in-vitro transcription Du H, et al. (2000): GS FT RG DP Valbuzzi A & Yanofsky C (2001): DB RG Yakhnin AV & Babitzke P (2002): RO

Terminator

Terminator sequence	Absolute position	Position from stop codon	Free energy [kcal/mol]	Downstream of
`CATTATGTTTATTCTACCCAAAAGAAGTCTTTCTTTTGGGTTTATTTGTTATATA >>>>>>>>>> <<<<<<<<<<`	2377488..2377511	-1642..-1619	-14.9	trpE
`AAAAATCCTGAAGTTTTACTTCAGGATTTTTTATGCAGATC >>>>>>>>> <<<<<<<<<`	2367939..2367959	-5..15	-14.6	aroE

Overview

Upper Region

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai