 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yaaDE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yaaD | + | 19062..19946 | COG0214H | yaaD-BAC | ||
| yaaE | + | 19968..20558 | COG0311H | yaaE-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | BSORF shows both a yaaDE transcript and a longer dacA-yaaDE-serS transcript |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Spo0A | Negative | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGCGAGAGCTCTCGTCCCTTTATGGGGATGAGGGCTCTTTTTATTTTCGATA >>>>>>>>>>>>>> <<<<<<<<<<<<<< |
yaaE |
|