 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ycdHI-yceA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ycdH | + | 307884..308843 | ||||
| ycdI | + | 308899..309594 | ||||
| yceA | + | 309552..310394 |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Gaballa A & Helmann JD (1998) |
| Comments: | Northern blotting results in BSORF show a ycdHI (1.7 kb) and a yceA (0.9 kb) transcript. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigA | Promoter | -43:+34 | 308229..308305 | ATTTATTCTTGCAAAACGTAATGACTTCGGTTTATTATGATATAGGATTACAAAATCGTTATCATTTTGATTTAAAG |
Gaballa A, et al. (2002): PE |
| Zur | Negative | +1:+35 | 308272..308306 | AGGATTACAAAATCGTTATCATTTTGATTTAAAGT |
Gaballa A & Helmann JD (1998): DB GS HM RG Gaballa A, et al. (2002): PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAAGCAGTTTTCCCTAGGGAAAACTGCTTTTTTTATAGAAAC >>>>>>>>>> <<<<<<<<<< |
yceA |
|