| Regulated Operon: | ydfO |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ydfO | mhqO | + | 597114..598052 | COG0346E |
| Operon evidence: | ND |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -45:+5 | 596815..596864 | AAGACACCGTTTCGTTTTATGAAAACAGGGGAGAACAATTTAAGAGAGAT |
Price CW, et al. (2001): RACE-PCR DB |


|