 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yflA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yflA | + | 844770..846185 | COG1115E |
| Operon evidence: | Northern blotting; downstream genes are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | -37:+5 | 844711..844752 | AAAGGTTTATGTTTTTCCATCTATGGGAAATGATTCATAAAC |
Petersohn A, et al. (1999): HB PE |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATACATGGCTTTCGGGTCGATTTTTGAGTGTAAAA >>>>> <<<<< |
yflA |
|