| Regulated Operon: | ygaO |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ygaO | - | 966196..966669 |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strands |
|---|---|
| Reference: | |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Spo0A | ND | ND | ND | ND |
Molle V, et al. (2003): GS CH |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AACGAAAAAAACTCCGGCGCGCTGTAATCGGCCGGAGTTTTTTCTTACCAGC >>>>>>>>>> <<<<<<<<< |
ygaO |


|