Regulated Operon: | yisY |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yisY | + | 1169043..1169849 | COG0596R |
Operon evidence: | upstream and downstream gene are on the opposite strand |
---|---|
Reference: | Kuwana R, et al. (2002) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigG | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
CATAAGAAAAAACCCGACATTGATCGGGTTTTTTATATAATTC >>>>> <<<<< |
yisY |
|