| Regulated Operon: | yodF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yodF | + | 2130377..2131867 | COG0591ER |
| Operon evidence: | Northern blotting (1.8 kb transcript); upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| TnrA | Negative | ND | 2130116..2130132 | TGTGATCTTTTCTTACA |
Yoshida K, et al. (2003): AR HM GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCATACGCGGCAGCCGCGTATGGTTTTTTTTACATTTC >>>>>>>>>> <<<<<<<<<< |
yodF |


|