Regulated Operon: | yodF |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
yodF | + | 2130377..2131867 | COG0591ER |
Operon evidence: | Northern blotting (1.8 kb transcript); upstream and downstream genes are on the opposite strand |
---|---|
Reference: | Yoshida K, et al. (2003) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
TnrA | Negative | ND | 2130116..2130132 | TGTGATCTTTTCTTACA |
Yoshida K, et al. (2003): AR HM GS |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACCATACGCGGCAGCCGCGTATGGTTTTTTTTACATTTC >>>>>>>>>> <<<<<<<<<< |
yodF |
|