Regulated Operon: | ysnF |
Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
---|---|---|---|---|---|---|
ysnF | + | 2898931..2899752 | COG3861S |
Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
---|---|
Reference: | Wipat A, et al. (1996) |
Comments: |
Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
---|---|---|---|---|---|
SigB | Promoter | ND | ND | ND |
Pragai Z, et al. (2002): RG |
Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
---|---|---|---|---|
AAAAACCTCAAATCCTAAATGGATTTGAGGTTTTTCTTTTGGTAC >>>>>>>>>> <<<<<<<<<< |
ysnF |
|