| Regulated Operon: | ysnF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ysnF | + | 2898931..2899752 | COG3861S |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Wipat A, et al. (1996) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigB | Promoter | ND | ND | ND |
Pragai Z, et al. (2002): RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCTCAAATCCTAAATGGATTTGAGGTTTTTCTTTTGGTAC >>>>>>>>>> <<<<<<<<<< |
ysnF |


|