| Regulated Operon: | ytcC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ytcC | + | 3157961..3159184 | COG0438M |
| Operon evidence: | Genome analysis; downstream genes are on the opposite strand |
|---|---|
| Reference: | Kuwana R, et al. (2002) |
| Comments: |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| SigK | Promoter | ND | ND | ND |
Kuwana R, et al. (2002): SDS-PAGE, RG |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAGCAAAAACATAAAACCTACAGCTCGTGTTGCAAAACGGGCTGTTTTTTCGCTACAGA >>>>>>>> <<<<<<<< |
ytcC |


|