 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yvcRS |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yvcR | - | 3565496..3566275 | COG1136V | x0167-BAC-1 | ||
| yvcS | - | 3563581..3565521 |
| Operon evidence: | Northern blot analysis |
|---|---|
| Reference: | Mascher T, et al. (2003) |
| Comments: | An antibiotics, bacitracin, induces yvcRS operon in the wild type strain. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| YvcP | Positive | ND | ND | ND |
Mascher T, et al. (2003): DP,HB |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TATGTAATATGAAATCCGGTCTGTTATCAGACCGGATTTTTGATTTATTGA >>>>>>>>> <<<<<<<<< |
yvcS |
|