Transcription factor: FNR

Factor type Unique (CRP/FNR family)
SWISS-PROT ND
SubtiList ND
Consensus seq. TGTGA------TCACA
Comment same binding consensus with E. coli CAP exists in the narK-fnr operon
Link to Phylogenetic profile, Weight matrix & Motif alignment

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
arfM arfM SigA Positive 3830671..3830694 -52:-29 AGGCTGTGAAATACATCACTGCTG Marino M, et al. (2001): RG SDM DB
Cruz Ramos H, et al. (1995): HM
Reents H, et al. (2006): AR
hemZ hemZ SigA Positive ND ND ND Homuth G, et al. (1999): RG
narGHJI narG SigA Positive 3830001..3830030 -53:-24 AGTGTGTGACATAGTTCACAAGGAAACACG Cruz Ramos H, et al. (1995): DB PE
Reents H, et al. (2006): DB NB AR RG SDM
narK-fnr narK SigA Positive 3833576..3833597 -52:-31 ACGTGTGATGTAATTCACAATC Cruz Ramos H, et al. (1995): DB PE
Reents H, et al. (2006): AR




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai