| Factor type | GntR |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | ATACTTGTATACAAGTAT |
| Comment | negatively autoregulates the expression of the gntRKPZ operon; inactivated by gluconate; suggested consensus of the gntR family is ACNNNTATANANNTAT |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| gntRKPZ | gntR | SigA | Negative | 4113373..4113394 | -10:+12 | ATACTTGTATACAAGTATACTC |
Yoshida K, et al. (1995): SDM GS FT |
|