 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | Unique |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | ND |
| Comment | proposed to mediate the histidine-dependent induction of hut operon expression through antitermination. HutP requires L-histidine and an Mg2+ ion for binding to the specific sequence within the hut mRNA. Kumarevel T, et al. (2005) show that several divalent cations can mediated the HutP-RNA interactions. It could not be replaced by monovalent cations. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| hut | hutH | SigA | Positive | 4041959..4042010 | Between hutP and hutH | CGATAGGGGGCTATGCGTGAAAACAGAAGTTCACAGCATAGCTCCTTTTTGT |
Wray LV Jr, et al. (1994): RO SDM Oda M, et al. (2000): GS |
|