 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | DtxR family |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | wAwTTTGCmTkArGGAAACT and others |
| Comment | regulation of manganese transport (repression of mntH in high Mn(II) conditions, activation of mntABCD under low Mn(II) conditions) |
| Link to | Phylogenetic profile, Weight matrix & Motif alignment |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| mntABCD | mntA | None | Positive at low Mn(II) concentration | 3146070..3146089 | None | AATTTTGCATGAGGGAAACT |
Que Q & Helmann JD (2000): DB GS RG HM |
| mntH | mntH | None | Negative at high Mn(II) concentration | 492465..492484 | None | TAATTTGCCTTAAGGAAACT |
Que Q & Helmann JD (2000): DB GS RG HM |
|