 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | transfer RNA |
|---|---|
| SWISS-PROT | Q04385 |
| SubtiList | BG00061 |
| Consensus seq. | aANNaGGGTGGtACCgCG |
| Comment | Uncharged tRNA-Cys binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| gltX-cysES-yazC-yacOP | cysE | SigA | Positive | 112689..112721 | None | CTTTTCAAACAGAGTGGAACCGCGCGGTTAAAG |
Gagnon Y, et al. (1994): HM NB OV RG |
|