 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | transfer RNA |
|---|---|
| SWISS-PROT | O31634 |
| SubtiList | BG00118 |
| Consensus seq. | aANNaGGGTGGtACCgCG |
| Comment | Uncharged tRNA-Val binds to the T-box sequence motif, promoting antitermination and transcriptional readthrough. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| valS-folC | valS | SigA | Positive | 2869375..2869417 | None | GATTGAGTTCATGAAAAAAGGTGGTACCGCGAAAGAGCTTTTC |
Grundy FJ & Henkin TM (1993): HM Luo D, et al. (1997): RG SDM OV |
|