Transcription factor: XylR

Factor type NagC/XylR
SWISS-PROT ND
SubtiList ND
Consensus seq. TTAGTTTGTTT-NNN-CAACAAACTAA
Comment repressor of xylAB operon. Exists upstream of the operon in the opposite direction. Xylose is the only molecular inducer of the repressor; the operator seems to consists of two tandem overlapping operators spaced by 4bp (see M.K.Dahl et al., 1994).
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
xylAB xylA SigA Negative 1891802..1891841 -5:+35 AAAATAAGTTAGTTTGTTTAAACAACAAACTAATAGGTGA Hastrup S (1988): Genetics and Biotechnology of Bacilli, Vol. 2, pp. 79-83: HM
Gartner D, et al. (1988): RG HM
Kreuzer P, et al. (1989): DP RG DB
Gartner D, et al. (1992): SDM GS FT RG
Dahl MK, et al. (1994): GS FT SDM
Dahl MK, et al. (1994): GS
xynPB xynP SigA Negative 1887028..1887065 -3:+35 GTCAAGTTAGTTTGTTTGATCAACAAACTAATGAAATG Hastrup S (1988): Genetics and biotechnology of Bacilli, vol.2 p.79-83: ND
Kreuzer P, et al. (1989): HM
Galinier A, et al. (1999): RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai