 |
Copyright: Human Genome Center, Inst. Med.
Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Factor type | AraC family |
|---|---|
| SWISS-PROT | ND |
| SubtiList | ND |
| Consensus seq. | ND |
| Comment | One-component regulator; Btr(YbbB) binds to apo-bacillibactin and Fe-bacillibactin, and increase the ability of transcriptional activator. |
| Link to | Phylogenetic profile |
| Operon | Regulated Gene | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|---|---|
| feuABC-ybbA | feuA | SigA | Positive | 183388..183428 | -70:-30 | GGAGATTGTCCATGATAAATCAGGAATTTGTCCATGGTGTT |
Gaballa A, et al. (2007): GS FT DB |
|