Regulated gene:ydaR
| Direction | - |
|---|---|
| Start position | 490698..491975 |
| Operon | ND |
| Transcription start site | |
| COG ID | COG1914 |
| Profile | related to the natural resistance associatedconditions by MntR |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|
| YqhN | Positive(lowMn(II))/Negative(highMn(II)) | ND | 492020..492039 | TAATTTGCCTTAAGGAAACT |
GS, beta-gal, HM | Que, Q., et al. | 2000 |
| YqhN | Negative | -60:-41 translation start site | 492020..492039 | TAATTTGCCTTAAGGAAACT |
DB GS HM | Que Q et al. | 2000 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2003
Contact: knakai@ims.u-tokyo.ac.jp