| Factor type | DtxR family |
|---|---|
| SWISS-PROT | P54512 |
| SubtiList | BG11702 |
| Consensus seq. | wAwTTTGCmTkArGGAAACT and others |
| Comment | regulation of manganese transport (repression of mntH in high Mn(II) conditions, activation of mntABCD under low Mn(II) conditions) |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| mntA | mntABCD | ND | Negative | 3145118..3145137 | ND | AATTTTGCATGAGGGAAACT |
GS, beta-gal, HM | Que, Q., et al. | 2000 |
| mntA | ND | ND | Positive | 3145118..3145136 | -112:-130 translation start site | ATTTTGCATGAGGGAAACT |
DB GS HM | Que Q et al. | 2000 |
| ydaR | ND | ND | Positive(lowMn(II))/Negative(highMn(II)) | 492020..492039 | ND | TAATTTGCCTTAAGGAAACT |
GS, beta-gal, HM | Que, Q., et al. | 2000 |
| ydaR | ND | ND | Negative | 492020..492039 | -60:-41 translation start site | TAATTTGCCTTAAGGAAACT |
DB GS HM | Que Q et al. | 2000 |