Regulated gene:ydbH
| Direction | + |
|---|---|
| Start position | 499723..500988 |
| Operon | ND |
| Transcription start site | 627620 |
| COG ID | COG1301 |
| Profile | inactivation causes a deficiency in utilizationelement in the -10 region of the promoter |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|
| CcpA | Negative | ND | 499660..499682 | TGTATGAAAACGCTATCATTCTA |
beta-gal | Miwa Y et al. | 2000 |
| YdbG | Positive | ND | ND | ND |
DB | Asai K et al. | 2000 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2003
Contact: knakai@ims.u-tokyo.ac.jp