| Factor type | Unique(CIRCE) |
|---|---|
| SWISS-PROT | P25499 |
| SubtiList | BG10662 |
| Consensus seq. | TTAGCACTC---------GAGTGCTAA |
| Comment | the promoters of class I heat-inducible genes are sigA-dependent and have an inverted repeat, called the CIRCE (controlling IR of chaperone expression) element, which is highly conserved among eubacteria heat-shock and general stress responses are reviewed in Hecker, M. et al., 1996 |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| groES | groES-groEL | SigA | Negative | 649388..649414 | +5:+31 | TTAGCACTCTTTAGTGCTGAGTGCTAA |
HB GS | Hecker M, et al. | 1996 |
| hrcA | hrcA-grpE-dnaK-dnaJ (?) | SigA | Negative | 2628875..2628901 | +5:+31 | TTAGCACTCGCTTATTGAGAGTGCTAA |
SDM HB | Zuber U, et al. | 1994 |