| Factor type | LuxR/UhpA |
|---|---|
| SWISS-PROT | P35163 |
| SubtiList | BG10534 |
| Consensus seq. | |
| Comment | resD seems to form a two-component signal transduction system with resE and plays a regulatory role in respiration interactions with resABCDE operon and ctaA may be indirect |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| ctaA | catA | ND | Positive | 1558343..1558395 | -108:-55 | TACATTTTCCAGAAGCCGTCATTCTATTATATTTTTGTGAACAAAAGGCT CTG |
GS, PE | Paul, S., et al. | 2001 |
| ctaA | catA | ND | Positive | ND | ND | ND |
DB | Sun G, et al. | 1996 |
| ctaB | catBCDEF | ND | Positive | ND | ND | ND |
resD-resE mutation | Liu X et al. | 1998 |
| fnr | ND | ND | Positive | 3831324..3831341 | -62:-44 | CATTCACAAGATTGTTAG |
ND | Nakano, M. M., et al. | 2001 |
| fnr | ND | ND | Positive | ND | ND | ND |
resD-resE mutation | Nakano MM et al. | 1996 |
| hemZ | hemZ | ND | Positive | ND | ND | ND |
beta-gal | Homuth G, et al. | 1999 |
| hmp | ND | ND | Positive | 1371979..1372018 | -79:-39 | ATTGATAATTTTGTGACAACTTTATTAAAGATTCATTTTA |
ND | Nakano, M. M., et al. | 2001 |
| hmp | ND | ND | Positive | ND | ND | ND |
resD-resE mutation | LaCelle M et al. | 1996 |
| lctE | lctE-lctP | ND | Positive | ND | ND | ND |
ND | Cruz Ramos, H., et al. | 2000 |
| nasD | nasDEF | ND | Positive | ND | ND | ND |
resD-resE mutation | Nakano MM et al. | 1998 |
| nasD | ND | ND | Positive | 357811..357854 | -83:-39 | TAAAATTTTTAGAACTTTTCGTATATTTTGTTACATTTTATAAC |
ND | Nakano, M. M., et al. | 2001 |
| phoP | phoP-phoR | ND | Positive | ND | ND | ND |
resD-resE mutation | Sun G et al. | 1996 |
| qcrA | petCBD operon | SigA | Positive | ND | ND | ND |
DB HB | Sun G, et al. | 1996 |
| resA | resA-resB-resC-resD-resE | ND | Positive | ND | ND | ND |
DB | Sun G, et al. | 1996 |
| sbo | sboA-sboX-albA-albB-albC-albD-albE-albF-albG | ND | Positive | ND | ND | ND |
resD-resE mutation | Nakano MM et al. | 2000 |