| Factor type | NtrC/NifA |
|---|---|
| SWISS-PROT | P38022 |
| SubtiList | BG10723 |
| Consensus seq. | GCAAAATAATTTTGCA(T/C)T |
| Comment | NtrC/NifA transcriptional activator (cf. LevR) sigma 54-dependent activators generally bind two inverted repeat sequences called UAS, which are located approx. 100bp upstream from the -12/-24 promoters DNA bending is used for activation (AhrC may be involved) inducible by ornithine or citrulline? at least upstream UAS1 is the target of RocR |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| rocA | rocABC | SigL | Positive | 3879729..3879752 | -217:-194 | CCTCCGCAAAATAATTTTGCATTT |
FT DP DB |
Ali, N. O., et al. Calogero S, et al. |
2003 1994 |
| rocA | rocABC | SigL | Positive | 3879680..3879708 | -173:-145 | AAAACGCAAAATAAATTTGCGTTCAAGAT |
FT DP DB |
Ali, N. O., et al. Calogero S, et al. |
2003 1994 |
| rocD | rocDEF | SigL | Positive | 4144687..4144707 | -130:-110 | TATGCAAAAGAATTTTGCACT |
DP HM | Gardan R, et al. | 1995 |
| rocD | rocDEF | SigL | Positive | 4144646..4144666 | -89:-69 | ATATCAGAATGTTTTTGCACC |
DP HM | Gardan R, et al. | 1995 |
| rocG | rocG | SigL | Positive | ND | DAS(Downstream activating sequence) | GS FT | Belitsky BR, et al. Ali, N. O., et al. |
1999 2003 |
|
| rocR | rocR | SigA | Negative | 4144687..4144707 | -30:-50 | TATGCAAAAGAATTTTGCACT |
DB PE | Gardan R, et al. | 1995 |