| Factor type | Xre |
|---|---|
| SWISS-PROT | P06533 |
| SubtiList | BG10754 |
| Consensus seq. | |
| Comment | dual-function regulator which is essential for the late-growth processes of competence and motility and is also a repressor of others, e.g., sporulation and subtilisin synthesis might be a leucine zipper protein in aprE there are two binding sites and SinR binds more strongly to the distal site which contains two dyad symmetry sites |
| Link to | Phylogenetic profile , Weight matrix & Motif alignment |
| Regulated gene |
Operon | Sigma | Regulation | Absolute position | Location | Binding seq.(cis-element) | Exp. | Reference | Year |
|---|---|---|---|---|---|---|---|---|---|
| aprE | ND | SigA | Negative | 1105150..1105195 | -265:-220 | ATTGTTCTCACGGAAGCACACGCAGGTCATTTGAACGAATTTTTTC |
DP GS FT | Gaur NK, et al. | 1991 |
| comK | ND | ND | Positive | ND | ND | ND |
DB | Hahn J, et al. | 1994 |
| rok | ND | ND | Negative | ND | ND | ND |
gel shift | Hoa, T. T., et al. | 2002 |
| spo0A | ND | SigH | Negative | 2518106..2518125 | -23:-4 | GTTTTGTCGAATGTAAACAT |
DB GS FT | Mandic Mulec I, et al. | 1995 |
| spoIIAA | ND | SigH | Negative | 2444244..2444263 | -51:-32 | GTTTTGTCACGGTGAAGGAA |
DB GS FT | Mandic Mulec I, et al. | 1995 |
| spoIIGA | ND | SigA | Negative | 1602944..1602958 | -90:-76 | AAATTAAGCAGATTT |
GS FT | Cervin MA et al. | 1998 |
| spoIIGA | ND | SigA | Negative | 1602962..1602977 | -72:-57 | TGAAAAATTGTATTTT |
GS FT | Cervin MA et al. | 1998 |
| spoIIGA | ND | SigA | Negative | 1602984..1602999 | -50:-35 | AACATTAATTGACAGA |
GS FT | Cervin MA et al. | 1998 |